Sequence ID | >WENV180096650 |
Genome ID | MTBK01140957 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 208 |
End posion on genome | 124 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
aaataataaa |
tRNA gene sequence |
GCGCGAGTGCTGGAATTGGCAGACAGGCTAGCTTGAGGGGCTAGTGTCCATTAGGACGTG |
Downstream region at tRNA end position |
aaaattaatt |
Secondary structure (Cloverleaf model) | >WENV180096650 Leu GAG a ACaa aaaattaatt G - C C - G G - C C - G G - C A - T G - C T A T C C C T C A T A A G | | | | | A T G G T C G G G A G C G | | | T T G A C A G C A G G TGTCCATTAGGACGT C - G T - A A - T G - C C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |