Sequence ID | >WENV180096669 |
Genome ID | MTBK01142171 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 549 |
End posion on genome | 460 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
atacattttT |
tRNA gene sequence |
GGAGCGGTGCGAGAGCGGTTGAATCGGGCTCCCTGCTAAGGAGTTGTACCCCGAAAGGGT |
Downstream region at tRNA end position |
aaaaatttga |
Secondary structure (Cloverleaf model) | >WENV180096669 Ser GCT T GTag aaaaatttga G - C G - C A - T G - C C - G G + T G - C T A T C C C C C A C G A G | | | | | G G G A G C G G G G G C G | | | T T T A T C G T G A G TGTACCCCGAAAGGGTACC G + T C - G T - A C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |