Sequence ID | >WENV180096672 |
Genome ID | MTBK01142214 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 2025 |
End posion on genome | 1954 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
atattatcaa |
tRNA gene sequence |
TGCCTTATGGTGTAATGGTAGCACAACAGTTTCTGGATCTGTTTGTCTAGGTTCGAATCC |
Downstream region at tRNA end position |
gtaggaaata |
Secondary structure (Cloverleaf model) | >WENV180096672 Gln CTG a ACta gtaggaaata T - A G - C C - G C - G T - A T - A A - T T A T G G T C C A A A G | + | | | G T T G T G C T A G G C G + | | | T T G G C A C T A A TTGT A - T C - G A - T G - C T T T A T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |