Sequence ID | >WENV180096677 |
Genome ID | MTBK01142487 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 407890 |
End posion on genome | 407816 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
gactctgaaa |
tRNA gene sequence |
GGGCCTTTAGCTCAGCTGGTTAGAGCGCGCCTCTGATAAGGGCGAGGTCTCAGGTTCGAA |
Downstream region at tRNA end position |
ttcagaccag |
Secondary structure (Cloverleaf model) | >WENV180096677 Ile GAT a ACtt ttcagaccag G - C G - C G - C C - G C - G T - A T - A T A T A G C C C A C G A A | | | | G T C T C G T C A G G C G | | | | T T G G A G C T T A G AGGTC C - G G - C C - G C - G T + G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |