Sequence ID | >WENV180096679 |
Genome ID | MTBK01142487 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 393347 |
End posion on genome | 393276 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
agaaaagggc |
tRNA gene sequence |
GCCGGCGTAGCTCAATGGTAGAGCAACCGCCTTGTAAGCGGTAGGTTATGAGTTCGATTC |
Downstream region at tRNA end position |
ttgaccattc |
Secondary structure (Cloverleaf model) | >WENV180096679 Thr TGT c Ttca ttgaccattc G - C C - G C - G G - C G + T C - G G - C T T T T A C T C A A A A | | | | | G T C T C G A T G A G C G | | | | T T G G A G C T A A AGGTT A - T C - G C - G G - C C - G C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |