Sequence ID | >WENV180096682 |
Genome ID | MTBK01142487 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 391494 |
End posion on genome | 391420 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
gaaagtaccT |
tRNA gene sequence |
AGGTCAGTAGCTCAATTGGCAGAGCACCGCTCTCCAAAAGCGGGGGCTGAGGGTTCGAGT |
Downstream region at tRNA end position |
atgttgattt |
Secondary structure (Cloverleaf model) | >WENV180096682 Trp CCA T GTtg atgttgattt A - T G - C G - C T - A C - G A - T G - C T G T C T T C C A T A A A | | + | | G T C T C G G A G G G C G | | | | T T G G A G C C A A GGGCT C - G C - G G - C C - G T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |