Sequence ID | >WENV180096684 |
Genome ID | MTBK01142487 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 268205 |
End posion on genome | 268132 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
caaaaaatat |
tRNA gene sequence |
GGGCCCATGGCGCAGTTGGGAGCGCGTCTCAATGGCATTGAGAAGGTCGAGAGTTCGAAT |
Downstream region at tRNA end position |
aaaaacgaac |
Secondary structure (Cloverleaf model) | >WENV180096684 Ala GGC t ACtc aaaaacgaac G - C G - C G + T C - G C - G C - G A - T T A T C T C T C A T G A G | | | | | G T C G C G G A G A G C G | | | | T T G G C G C G A G AGGTC T - A C - G T - A C - G A - T A T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |