Sequence ID | >WENV180096687 |
Genome ID | MTBK01142502 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 442 |
End posion on genome | 513 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
attagcagca |
tRNA gene sequence |
GGCGAAGTAGCTCAATGGTAGAGCAGTGGACTCATAAGCCATTGGTTGTCGGTTCGAATC |
Downstream region at tRNA end position |
aagaaaatct |
Secondary structure (Cloverleaf model) | >WENV180096687 Met CAT a Atgt aagaaaatct G - C G - C C - G G - C A - T A - T G - C T A T C C G C C A A A A | | | | G T C T C G G T C G G C G | | | | T T G G A G C T A A TGGTT G + T T - A G - C G - C A G C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |