Sequence ID | >WENV180096718 |
Genome ID | MTBK01144089 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 112693 |
End posion on genome | 112620 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
gcgtataaac |
tRNA gene sequence |
TGGGGAATCGTCCAATGGCAGGACACCTGACTCTGGATCAGGCAATCTTGGTTCGAATCC |
Downstream region at tRNA end position |
gcaagcaaag |
Secondary structure (Cloverleaf model) | >WENV180096718 Gln CTG c GCCA gcaagcaaag T - A G - C G - C G - C G - C A - T A - T T A T G G A C C A A A C | + | | | G T C C T G C T T G G C G | | | | T T G G G A C C A A CAAT C - G C - G T - A G - C A - T C A T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |