Sequence ID | >WENV180096735 |
Genome ID | MTBK01144849 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 75695 |
End posion on genome | 75769 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
tggtctgact |
tRNA gene sequence |
GGGGCTGTAGCGCAGTGGGAGCGCGCTTCCCTCGCACGGAAGAGGCCGGGGGTTCGAATC |
Downstream region at tRNA end position |
gggactgcca |
Secondary structure (Cloverleaf model) | >WENV180096735 Ala CGC t ACCA gggactgcca G - C G - C G + T G - C C - G T - A G - C T A T C C C C C A G A A | | | | | G T C G C G G G G G G C G | | | | T T G G C G C G A G AGGCC C - G T - A T - A C - G C - G C C T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |