Sequence ID | >WENV180096742 |
Genome ID | MTBK01144849 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 77917 |
End posion on genome | 78000 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
atcgtccggc |
tRNA gene sequence |
GCGAGAGTGGTGGAACGGCAGACACGCTGGACTTAGGATCCAGTGCTTTCGGGCATGGGG |
Downstream region at tRNA end position |
tttttatccc |
Secondary structure (Cloverleaf model) | >WENV180096742 Leu TAG c ACCA tttttatccc G - C C - G G - C A - T G - C A - T G - C T G T C C C C C A C A A G | | | | | G G G G T G G G G G G C G | | | T T C A C A C A G G TGCTTTCGGGCAT C - G T - A G - C G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |