Sequence ID | >WENV180096744 |
Genome ID | MTBK01144849 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 236735 |
End posion on genome | 236649 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
tgtcgtatgc |
tRNA gene sequence |
GGGAGTGTGGCGGAATCGGTAGACGCAGCGGACTTAAAATCCTCCGGGCAATGGCCCTTA |
Downstream region at tRNA end position |
acagggatgg |
Secondary structure (Cloverleaf model) | >WENV180096744 Leu TAA c ACCA acagggatgg G - C G - C G - C A - T G - C T - A G - C T G T T G C C C A T A A G | | | | | G C G G C G A C G G G C G | | | T T G A C G C T A G A CGGGCAATGGCCCTT G - C C T G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |