Sequence ID | >WENV180096760 |
Genome ID | MTBK01146292 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 869 |
End posion on genome | 785 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
agtattaggc |
tRNA gene sequence |
GCGAGAGTTGCCAAGCCAGGTCAAAGGCGCCAGGTTCAGGGCCTGGTCTCGTAGGAGTTC |
Downstream region at tRNA end position |
ttcttttgat |
Secondary structure (Cloverleaf model) | >WENV180096760 Leu CAG c Attc ttcttttgat G - C C - G G - C A - T G - C A - T G - C T A T C G G C C A C C G A T | | | | | G A A C C G G C C G G C G | | | T T G A G G C T C A A G TCTCGTAGGAGTTC C - G C - G A - T G - C G - C T G T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |