Sequence ID | >WENV180096766 |
Genome ID | MTBK01146764 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 8332 |
End posion on genome | 8416 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
gaatttataa |
tRNA gene sequence |
GGGGGGATACCAAAGTGGCCAACTGGGGCAGACTGTAAATCTGTTGTCTTACGACTTCGG |
Downstream region at tRNA end position |
ataaaagcat |
Secondary structure (Cloverleaf model) | >WENV180096766 Tyr GTA a ACCc ataaaagcat G - C G - C G - C G - C G - C G - C A - T T A T C C T C C A T G A A | | | | | G G A A C C G G A G G C G | | | T T C C T G G C A A G TGTCTTACGACTTC G + T C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |