Sequence ID | >WENV180096780 |
Genome ID | MTBK01147508 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 863 |
End posion on genome | 775 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
caacctgtga |
tRNA gene sequence |
GGAGAGTTGTCCGAGTTGGTCTAAGGAGCACGACTGGAAATCGTGTAAGTCGAAAGGCTT |
Downstream region at tRNA end position |
tcaagtaaag |
Secondary structure (Cloverleaf model) | >WENV180096780 Ser GGA a GCCA tcaagtaaag G - C G - C A - T G - C A - T G - C T + G T A T T T C C C A T T G A G + | | | | G G G C C T G A G G G C G | | | T T T A G G A C T A G TAAGTCGAAAGGCTTC C - G A - T C - G G - C A - T C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |