Sequence ID | >WENV180096809 |
Genome ID | MTBK01149772 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 516 |
End posion on genome | 434 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
tggggcacgc |
tRNA gene sequence |
GCGCGAGTGGCGGAATTGGCAGACGCGCCAGATTTAGGTTCTGGTGCCCTCGGGTGTGCG |
Downstream region at tRNA end position |
ggccgagcga |
Secondary structure (Cloverleaf model) | >WENV180096809 Leu TAG c ACgt ggccgagcga G - C C - G G - C C - G G - C A - T G - C T G T C G C C C A T A A G | | | | | A T G G C G G C G G G C G | | | T T G A C G C C A G G TGCCCTCGGGTGT C - G C - G A - T G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |