Sequence ID | >WENV180096830 |
Genome ID | MTBK01151119 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 104721 |
End posion on genome | 104646 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
taaatggttt |
tRNA gene sequence |
GCTGGCGTAGCTCAATCGGTAGAGCAGCTGATTTGTAATCAGCAGGTTGCGGGTTCGAGT |
Downstream region at tRNA end position |
gatgagcaac |
Secondary structure (Cloverleaf model) | >WENV180096830 Thr TGT t TCCA gatgagcaac G - C C - G T - A G - C G - C C - G G - C T G T T A C C C A T A A A + | | | G C C T C G G C G G G C G | | | | T T G G A G C T A A AGGTT G - C C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |