Sequence ID | >WENV180096831 |
Genome ID | MTBK01151119 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 104629 |
End posion on genome | 104545 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
caacataccc |
tRNA gene sequence |
GGAGGGGTTCCCGAGCGGCCAAAGGGAGCAGACTGTAAATCTGCCGGCGGAGCCTACGGA |
Downstream region at tRNA end position |
gttttttgaa |
Secondary structure (Cloverleaf model) | >WENV180096831 Tyr GTA c ACCA gttttttgaa G - C G - C A - T G - C G - C G - C G - C T A T C C T C C A C G A T | | | | | A G G C C C G G A G G C G | | | T T C A G G G C A A A CGGCGGAGCCTAC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |