Sequence ID | >WENV180096832 |
Genome ID | MTBK01151119 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 104530 |
End posion on genome | 104455 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
tttgaaataa |
tRNA gene sequence |
GCGGGAGTAGCTCAGGGGCTAGAGCGTCAGCCTTCCAAGCTGAGGGTCGCGGGTTCGAAT |
Downstream region at tRNA end position |
ggttgctttt |
Secondary structure (Cloverleaf model) | >WENV180096832 Gly TCC a TCCA ggttgctttt G - C C - G G - C G - C G - C A - T G + T T A T T G C C C A G G A A + | | | | G G C T C G G C G G G C G | | | | T T C G A G C T A G GGGTC T - A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |