Sequence ID | >WENV180096833 |
Genome ID | MTBK01151119 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 104418 |
End posion on genome | 104343 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
ggaacgccgc |
tRNA gene sequence |
GCCCACGTAGCTCAGTCGGTAGAGCACATCCTTGGTAAGGATGAGGTCACCAGTTCGATC |
Downstream region at tRNA end position |
gtgaaggaga |
Secondary structure (Cloverleaf model) | >WENV180096833 Thr GGT c TCCA gtgaaggaga G - C C - G C - G C - G A - T C - G G - C C T T T G G T C A T G A A | | | | | G C C T C G A C C A G C G | | | | T T G G A G C T A A AGGTC C - G A - T T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |