Sequence ID | >WENV180096836 |
Genome ID | MTBK01151125 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 23200 |
End posion on genome | 23126 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
agaggctaac |
tRNA gene sequence |
GGGCGGTTAGCTCAGTGGTAGAGCGCTTGTTTCACACACAAGAGGTCAGAGGTTCGAATC |
Downstream region at tRNA end position |
agaaagtgcg |
Secondary structure (Cloverleaf model) | >WENV180096836 Val CAC c ACCA agaaagtgcg G - C G - C G - C C - G G - C G - C T - A T A T T C T C C A G A A | | | | | G T C T C G A G A G G C G | | | | T T G G A G C T A G AGGTC C - G T - A T - A G - C T - A T C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |