Sequence ID | >WENV180096837 |
Genome ID | MTBK01151125 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 23118 |
End posion on genome | 23044 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
ccaagaaagt |
tRNA gene sequence |
GCGGGAGTAGCTCAGTGGTAGAGCATCTGCTTGCCATGCAGAGGGTCGCGGGTTCGAATC |
Downstream region at tRNA end position |
ttgtttttgt |
Secondary structure (Cloverleaf model) | >WENV180096837 Gly GCC t TCCA ttgtttttgt G - C C - G G - C G - C G - C A - T G - C T A T T G C C C A G A A + | | | | G T C T C G G C G G G C G | | | | T T G G A G C T A A GGGTC T - A C - G T - A G - C C - G T T T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |