Sequence ID | >WENV180096838 |
Genome ID | MTBK01151125 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 23009 |
End posion on genome | 22935 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
gggtggatag |
tRNA gene sequence |
GCCGGCGTAGCTCAACGGCAGAGCAGCTGATTCGTAATCAGCAGGTTCCCAGTTCAAGTC |
Downstream region at tRNA end position |
ttttcttctt |
Secondary structure (Cloverleaf model) | >WENV180096838 Thr CGT g TCCA ttttcttctt G - C C - G C - G G - C G - C C - G G - C T G T G G G T C A A A A | | | | | A C C T C G C C C A G C G | | | | T T G G A G C C A A AGGTT G - C C - G T - A G - C A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |