Sequence ID | >WENV180096839 |
Genome ID | MTBK01151125 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 19571 |
End posion on genome | 19497 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
ataacagctg |
tRNA gene sequence |
CGGGGCGTAGCGCAGTGGTAGCGCACTCGTTTGGGGTGCGAGTGGTCGGCGGTTCGAGTC |
Downstream region at tRNA end position |
tttgtttttt |
Secondary structure (Cloverleaf model) | >WENV180096839 Pro GGG g ACCA tttgtttttt C - G G - C G - C G - C G - C C - G G - C T G T C C G C C A G A A | | | | | G T C G C G G G C G G C G | | | | T T G G C G C T A A TGGTC C - G T - A C - G G - C T + G T T T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |