Sequence ID | >WENV180096842 |
Genome ID | MTBK01151332 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 997 |
End posion on genome | 1072 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
attaaaatac |
tRNA gene sequence |
TGCGGCGTGGAGTAAAGGTAACTCAACAGTCTCATAAGCTGTTTTCGTGAGGGTTCGAGT |
Downstream region at tRNA end position |
tagagatcga |
Secondary structure (Cloverleaf model) | >WENV180096842 Met CAT c ACCA tagagatcga T T G - C C - G G - C G - C C - G G - C T G T C T C C C A A A G | | | | | G A T G A G G A G G G C G | | | | T T G A C T C T A A TTTCGT A - T C - G A - T G - C T + G C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |