Sequence ID | >WENV180096844 |
Genome ID | MTBK01151383 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 512 |
End posion on genome | 428 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
taataattgt |
tRNA gene sequence |
GTCGGAGTGGTGGAATGGGCAGACACGCCAGTTTGAGGGACTGGTTCCGAAAGGAGTAGG |
Downstream region at tRNA end position |
atagcaaaat |
Secondary structure (Cloverleaf model) | >WENV180096844 Leu GAG t ACCA atagcaaaat G + T T - A C - G G - C G - C A - T G - C T A T T C C C C A T A A G | | | | | A G G G T G A G G G G C G | | | T T G A C A C C A G G TTCCGAAAGGAGT C - G C - G A - T G - C T - A T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |