Sequence ID | >WENV180096854 |
Genome ID | MTBK01152113 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 312 |
End posion on genome | 396 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
acgtcataaa |
tRNA gene sequence |
CGGAGTAGTGGCGGGTCTGGTTTCGCTTCCAGTTTTGGGAACTGGCGCCGTAAGGCATCG |
Downstream region at tRNA end position |
cttgttgttg |
Secondary structure (Cloverleaf model) | >WENV180096854 Pro TGG a ACta cttgttgttg C - G G - C G - C A - T G - C T - A A - T T A G C T T C C A C T G G T | | | | | G T G C G G G A A G G C G | | | + T T G C G C T T T T T CGCCGTAAGGCATC C - G C - G A - T G - C T - A T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |