Sequence ID | >WENV180096863 |
Genome ID | MTBK01152563 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 495 |
End posion on genome | 410 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
cggcgcgtcc |
tRNA gene sequence |
GGAGGGGTGCCCGAGCGGCTAAAGGGGACGGTCTGTAAAACCGTTGGCGCACGCCTACGT |
Downstream region at tRNA end position |
cgaagcagtg |
Secondary structure (Cloverleaf model) | >WENV180096863 Tyr GTA c ACCA cgaagcagtg G - C G - C A - T G - C G - C G - C G - C T A T C A T C C A C G A G | | | | | G G G C C C G T A G G C G | | | T T C A G G G T A A G TGGCGCACGCCTAC A - T C - G G - C G - C T - A C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |