Sequence ID | >WENV180096889 |
Genome ID | MTBK01153801 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 9318 |
End posion on genome | 9403 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
tttcctgctt |
tRNA gene sequence |
GCCGAAGTGGTGGAATTGGTAGACACGCTATCTTGAGGGGGTAGTGGGCCACGCCCGTGC |
Downstream region at tRNA end position |
tgattataac |
Secondary structure (Cloverleaf model) | >WENV180096889 Leu GAG t ACCA tgattataac G - C C - G C - G G - C A - T A - T G - C T A T T G A C C A T A A G + | | | | A T G G T G G C T G G C G | | | T T G A C A C T A G G TGGGCCACGCCCGT C - G T - A A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |