Sequence ID | >WENV180096903 |
Genome ID | MTBK01154576 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 257 |
End posion on genome | 171 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
atcatttttT |
tRNA gene sequence |
GCGAGGATTGCCGAGCCAGGTCAAAGGCGGTGGATTTAGGGTCCACTCCCGCAGGGGTCC |
Downstream region at tRNA end position |
cttattaaaa |
Secondary structure (Cloverleaf model) | >WENV180096903 Leu TAG T ATtc cttattaaaa G - C C - G G - C A - T G - C G - C A - T T A T T C C A C A C C G A T | | | | | A A G C C G A G G T G C G | | | T T G A G G C T C A A G TCCCGCAGGGGTCC G - C T - A G - C G - C A - T T G T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |