Sequence ID | >WENV180096930 |
Genome ID | MTBK01156174 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 6142 |
End posion on genome | 6071 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
gcagcataaa |
tRNA gene sequence |
GGTCTCATGGCCGAGTGGCTAGGCAGAGGTCTGCAAAACCTCCTACAGCGGTTCGAATCC |
Downstream region at tRNA end position |
aaagtctttt |
Secondary structure (Cloverleaf model) | >WENV180096930 Cys GCA a TCag aaagtctttt G - C G - C T - A C - G T - A C - G A - T T A T T C G C C A G A G | | | | | G T G C C G A G C G G C G | | | T T G A G G C C T A CTAC G - C A - T G - C G - C T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |