Sequence ID | >WENV180096931 |
Genome ID | MTBK01156182 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1632 |
End posion on genome | 1714 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ggtgcgtcct |
tRNA gene sequence |
GGCGAGTTACCCAAGCGGCCAAAGGGATCTGACTGTAAATCAGACTGCTCAGCATTCGGG |
Downstream region at tRNA end position |
catgaacaag |
Secondary structure (Cloverleaf model) | >WENV180096931 Tyr GTA t ACaa catgaacaag G - C G - C C - G G - C A - T G - C T - A T A T C T C C C A C G A A | + | | | G G A C C C G G G G G C G | | | T T C A G G G C A A A CTGCTCAGCATTC T - A C - G T - A G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |