Sequence ID | >WENV180096950 |
Genome ID | MTBK01157153 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1383 |
End posion on genome | 1458 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
caaaatttaa |
tRNA gene sequence |
TGGCTAGTGGTAGATTGGTAATACAGCACACTGTTAATGTGCCTTTATGGGGGTTCGAGT |
Downstream region at tRNA end position |
attgttattt |
Secondary structure (Cloverleaf model) | >WENV180096950 Asn GTT a GCCA attgttattt T - A G - C G - C C - G T - A A - T G - C T G T C T C C C A T A G | + | | | G T G A T G G G G G G C G | | | T T G A T A C T A A CTTTAT G - C C - G A - T C - G A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |