Sequence ID | >WENV180096993 |
Genome ID | MTBK01160841 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 2215 |
End posion on genome | 2302 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
tcatgctgtt |
tRNA gene sequence |
GCCGGGGTGATGGAATTGGCAGTCATGCGCGACTCAAAATCGCGTGGGGTAGCCCCCCGT |
Downstream region at tRNA end position |
ttttttgcct |
Secondary structure (Cloverleaf model) | >WENV180096993 Leu CAA t ACCA ttttttgcct G - C C - G C - G G - C G - C G - C G - C T C T C G C C C A T A A G | | | | | G T G G T A G C G G G C G + | | | T T G T C A T C A G G TGGGGTAGCCCCCCGT C - G G - C C - G G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |