Sequence ID | >WENV180097031 |
Genome ID | MTBK01162843 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 460 |
End posion on genome | 376 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
atagctgtgg |
tRNA gene sequence |
GCCGAAGTGGTGGAATAGGTAGACACAAGGGACTTAAAATCCCTTGCTCTTCGGGGCGTA |
Downstream region at tRNA end position |
tagttacaaa |
Secondary structure (Cloverleaf model) | >WENV180097031 Leu TAA g ACat tagttacaaa G - C C - G C - G G - C A - T A - T G - C T G T T G C T C A T A A G | | | | | A A G G T G A C G A G C G | | | T T G A C A C T A G A TGCTCTTCGGGGCGT A - T G - C G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |