Sequence ID | >WENV180097041 |
Genome ID | MTBK01163882 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 144614 |
End posion on genome | 144687 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
cgcactcgat |
tRNA gene sequence |
TGGCGGTTCGTCTAATGGTAGGACAGCGGACTCTGAATCCGTATGTAGAGGTTCGAATCC |
Downstream region at tRNA end position |
atacaaaaac |
Secondary structure (Cloverleaf model) | >WENV180097041 Gln CTG t GCCA atacaaaaac T - A G - C G - C C - G G - C G - C T - A T A T T T T C C A A A C | + | | | G T T C T G A G A G G C G + | | | T T G G G A C T A A ATGT G + T C - G G - C G - C A - T C A T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |