Sequence ID | >WENV180097063 |
Genome ID | MTBK01165661 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 87 |
End posion on genome | 1 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
ttgaaaaact |
tRNA gene sequence |
GCTCGGGTGGTGGAATAGGTAGACACGCAGGACTTAAAATCCTGTGGACAGTAATGTCCG |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV180097063 Leu TAA t ACnn nnnnnnnnnn G - C C - G T - A C - G G - C G - C G - C T T T T G C C C A T A A G | | | | | G A G G T G A C G G G C G | | | T T G A C A C T A G G TGGACAGTAATGTCCGT C - G A - T G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |