Sequence ID | >WENV180097084 |
Genome ID | MTBK01166652 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1766 |
End posion on genome | 1682 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
tttcagtcgt |
tRNA gene sequence |
GGGGGGATGCCCGAGTGGTTAAAGGGGGCAGACTGTAAATCTGTTGCCGATGGCTACACT |
Downstream region at tRNA end position |
aaatcaggtt |
Secondary structure (Cloverleaf model) | >WENV180097084 Tyr GTA t ACCA aaatcaggtt G - C G - C G - C G - C G - C G - C A - T T A T T G A C C A T G A G | | | | | A G G C C C A C T G G C G | | | T T T A G G G T A A G TGCCGATGGCTAC G + T C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |