Sequence ID | >WENV180097092 |
Genome ID | MTBK01166791 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 23655 |
End posion on genome | 23573 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
gcatgaaaaT |
tRNA gene sequence |
GCGAGAGTGGTGGAACGGCAGACACGCCAGACTTAGGATCTGGTGCCTTCAGGCGTAAGG |
Downstream region at tRNA end position |
tactttccta |
Secondary structure (Cloverleaf model) | >WENV180097092 Leu TAG T AGga tactttccta G - C C - G G - C A - T G - C A - T G - C T G T T T C C C A C A A G | | | | | A G G G T G A A G G G C G | | | T T C A C A C A G G TGCCTTCAGGCGT C - G C - G A - T G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |