Sequence ID | >WENV180097093 |
Genome ID | MTBK01166791 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 23502 |
End posion on genome | 23431 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
cttaatgcat |
tRNA gene sequence |
GCGGGAATAGCTCAGTGGTAGAGCGTCACCTTGCCAAGGTGGATGTCGCGGGTTCAATCC |
Downstream region at tRNA end position |
acaacagggc |
Secondary structure (Cloverleaf model) | >WENV180097093 Gly GCC t Ttcg acaacagggc G - C C - G G - C G - C G - C A - T A - T C T T T G C C C A G A A + | | | | A T C T C G G C G G G C G | | | | T T G G A G C T A G ATGTC T + G C - G A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |