Sequence ID | >WENV180097107 |
Genome ID | MTBK01168527 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 332 |
End posion on genome | 246 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
agcagacaat |
tRNA gene sequence |
GCGAGCGTGGCGGAATCGGCAGACGCGCTAGGTTCAGGACCTAGTGGGCGCAAGCCCGTG |
Downstream region at tRNA end position |
cgataatgtc |
Secondary structure (Cloverleaf model) | >WENV180097107 Leu CAG t ACCA cgataatgtc G - C C - G G - C A - T G - C C - G G - C T G T T T C C C A T A A G + + | | | A C G G C G G G G G G C G | | | T T G A C G C C A G G TGGGCGCAAGCCCGT C - G T - A A - T G - C G - C T A T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |