Sequence ID | >WENV180097118 |
Genome ID | MTBK01169471 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 2016 |
End posion on genome | 2103 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
ataaatacct |
tRNA gene sequence |
GCGGGCGTGGCGGAACTGGCAGACGCGCTGGACTTAGGATCCAGTGGGAGCACATCCCTT |
Downstream region at tRNA end position |
ttgatgtaca |
Secondary structure (Cloverleaf model) | >WENV180097118 Leu TAG t ACCA ttgatgtaca G - C C - G G - C G - C G - C C - G G - C T A T T C T C C A C A A G + | | | | A T G G C G G G A G G C G | | | T T G A C G C C A G G TGGGAGCACATCCCTT C - G T - A G - C G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |