Sequence ID | >WENV180097120 |
Genome ID | MTBK01169575 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 252 |
End posion on genome | 168 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
aaatcggaaa |
tRNA gene sequence |
GCCCGGGTGGCGGAATAGGTAGACGCGCTGGATTCAAAATCCAGTTCTGGCAACAGAGTG |
Downstream region at tRNA end position |
aaaaaccacg |
Secondary structure (Cloverleaf model) | >WENV180097120 Leu CAA a ACga aaaaaccacg G + T C - G C - G C - G G - C G - C G + T T T T C G C C C A T A A G | | | | | G A G G C G G C G G G C G | | | T T G A C G C T A G G TTCTGGCAACAGAGT C - G T - A G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |