Sequence ID | >WENV180097153 |
Genome ID | MTBK01171571 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 674 |
End posion on genome | 589 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
atggtccggc |
tRNA gene sequence |
GCGAGCGTGGTGGAACTGGCAGACACGCCGGGTTTAGGTCCCGGTGGACCGTGGTCCGTG |
Downstream region at tRNA end position |
gctgggtgac |
Secondary structure (Cloverleaf model) | >WENV180097153 Leu TAG c ACCc gctgggtgac G - C C - G G - C A - T G - C C - G G - C T G T C C C T C A C A A G | | | | | G T G G T G G G G A G C G | | | T T G A C A C C A G G TGGACCGTGGTCCGT C - G C - G G - C G - C G - C T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |