Sequence ID | >WENV180097162 |
Genome ID | MTBK01171943 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 382 |
End posion on genome | 464 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
tgtcccgcgc |
tRNA gene sequence |
GGAGGGTTAGCGTAATGGTAACGCACCGGTCTTGAAAACCGGCGCCTTCGGGCTTGGGGG |
Downstream region at tRNA end position |
cttcttaaac |
Secondary structure (Cloverleaf model) | >WENV180097162 Ser TGA c GCCA cttcttaaac G - C G - C A - T G - C G - C G - C T - A T G T C T C C C A A A A | + | | | G T T G C G G G G G G C G | | | | T T G A C G C T A A CGCCTTCGGGCTT C - G C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |