Sequence ID | >WENV180097175 |
Genome ID | MTBK01172683 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 8704 |
End posion on genome | 8613 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
attatatact |
tRNA gene sequence |
GGAGAGGTGGCTGAGTACGGCTGAAGGCGCTCGATTGGAAATCGAGTAACGTGTGAAAGC |
Downstream region at tRNA end position |
ttaatttcta |
Secondary structure (Cloverleaf model) | >WENV180097175 Ser GGA t GCCA ttaatttcta G - C G - C A - T G - C A - T G - C G - C T A T C A C C C A A T G A G | | | | | A C G T C G G T G G G C G + | | T T G A G G C C T G A G TAACGTGTGAAAGCGTTC C - G T - A C - G G - C A - T T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |