Sequence ID | >WENV180097200 |
Genome ID | MTBK01174270 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 872 |
End posion on genome | 787 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
caaggttgac |
tRNA gene sequence |
GCCGGAGTGGCGGAAAGGCAGACGCAGGGGACTTAAAATCCTCTGTCCGCAAGGACGTGC |
Downstream region at tRNA end position |
gctatttgta |
Secondary structure (Cloverleaf model) | >WENV180097200 Leu TAA c ACCA gctatttgta G - C C - G C - G G - C G - C A - T G - C T A T C G C C C A A A A G | | | | | G G G G C G G C G G G C G | | | T T C A C G C A G A TGTCCGCAAGGACGT G - C G + T G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |