Sequence ID | >WENV180097216 |
Genome ID | MTBK01175249 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 8665 |
End posion on genome | 8576 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
tgtcattgaa |
tRNA gene sequence |
GGAGAGGTGGCCGAGTGGTCTAAGGCGCGCGCCTGGAAAGTGCGTAAACTCCAAAAGGGT |
Downstream region at tRNA end position |
gtttttattt |
Secondary structure (Cloverleaf model) | >WENV180097216 Ser GGA a GCCg gtttttattt G - C G - C A - T G - C A - T G + T G - C T A T C G C C C A T G A G | | | | | G G G C C G G C G G G C G | | | T T T A G G C C T A G TAAACTCCAAAAGGGTTTC C - G G - C C - G G + T C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |