Sequence ID | >WENV180097226 |
Genome ID | MTBK01175629 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 590 |
End posion on genome | 502 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
tgtttgaaga |
tRNA gene sequence |
GGAGGGATGCCTGAGTGGTCGAAAGGGGAGCACTCGAAATGCTTTATTCCATTTATTTGG |
Downstream region at tRNA end position |
cgctaactta |
Secondary structure (Cloverleaf model) | >WENV180097226 Ser CGA a Gttc cgctaactta G - C G - C A - T G - C G - C G - C A - T T A T C T C C C A T G A G | + | | | G G G T C C G G G G G C G | | | T T T A A G G C G A G TATTCCATTTATTTGGAATC G + T A - T G - C C - G A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |