Sequence ID | >WENV180097245 |
Genome ID | MTBK01176112 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 37853 |
End posion on genome | 37938 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
tcggtcattc |
tRNA gene sequence |
GGGCGAGTGGCGGAATGGCAGACGCGCTGGCTTCAGGTGCCAGTGTCCTCCGGGACGTGG |
Downstream region at tRNA end position |
gattgacaaa |
Secondary structure (Cloverleaf model) | >WENV180097245 Leu CAG c ACCA gattgacaaa G - C G - C G - C C - G G - C A - T G + T T G T C C C C C A T A A G | | | | | A G G G C G G G G G G C G | | | T T C A C G C A G G TGTCCTCCGGGACGT C - G T - A G - C G - C C - G T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |